Jatropha Genome Database

JcCA0075121.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0075121.10 + phase: 0 /partial
         (224 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268520168|gb|FM890016.1|FM890016 FM890016 Jatropha curcas emb...   100   1e-21
gi|268524980|gb|FM896610.1|FM896610 FM896610 Jatropha curcas emb...    86   2e-17

>gi|268520168|gb|FM890016.1|FM890016 FM890016 Jatropha curcas embryo
           35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_003792,
           mRNA sequence
          Length = 492

 Score = 99.6 bits (50), Expect = 1e-21
 Identities = 172/213 (80%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcttctcacattgttggataccctcgtatgggccccaagagagagcttaagtttgca 60
           ||||| || |||||||| || |||||||| ||||| ||||||||||| || |||||||||
Sbjct: 215 atggcgtcacacattgtcggttaccctcgcatggggcccaagagagaactcaagtttgca 274

                                                                       
Query: 61  ttggaatctttttgggatgggaagagcagcgctcaggatttggaaaaggtagcatttgag 120
           |||||||| || ||||||||  | ||||| ||| |||| ||| ||||||| |||   || 
Sbjct: 275 ttggaatccttctgggatggncaaagcagtgctgaggaattgcaaaaggtggcagcagat 334

                                                                       
Query: 121 ctcagggaatctatctggaagcagatggctggtgctgggatcaaatacatccccagcaat 180
           || |||  ||| ||||||||||||||||||| | |||  ||||| |  || || ||||||
Sbjct: 335 cttaggtcatccatctggaagcagatggctgattctgacatcaagtttattccaagcaat 394

                                            
Query: 181 actttctcttactatgatcaggtgcttgacacc 213
           ||||| || || |||||||| ||| | ||||||
Sbjct: 395 actttttcatattatgatcaagtgttggacacc 427


>gi|268524980|gb|FM896610.1|FM896610 FM896610 Jatropha curcas embryo
           71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_003871,
           mRNA sequence
          Length = 589

 Score = 85.7 bits (43), Expect = 2e-17
 Identities = 43/43 (100%)
 Strand = Plus / Plus

                                                      
Query: 182 ctttctcttactatgatcaggtgcttgacaccacagcattgct 224
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5   ctttctcttactatgatcaggtgcttgacaccacagcattgct 47