Jatropha Genome Database

JcCA0071981.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0071981.10 + phase: 0 /pseudo/partial
         (750 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268521982|gb|FM892822.1|FM892822 FM892822 Jatropha curcas emb...    54   2e-07
gi|237680672|gb|GO246884.1|GO246884 JcrME_RL0428 Expressed seque...    50   4e-06

>gi|268521982|gb|FM892822.1|FM892822 FM892822 Jatropha curcas embryo
           56-70 (DAF) Jatropha curcas cDNA clone rjcaeb0_003477,
           mRNA sequence
          Length = 402

 Score = 54.0 bits (27), Expect = 2e-07
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 571 tatactttcccgcaggcagagcaagttaaagaattcttggaggatccaagcaaatttgc 629
           ||||| ||||| ||||||||| |||| || || | |||||||||||||||||| |||||
Sbjct: 373 tataccttcccacaggcagagaaagtgaaggagtacttggaggatccaagcaagtttgc 315


>gi|237680672|gb|GO246884.1|GO246884 JcrME_RL0428 Expressed sequence
           tags from Jatropha curcas root cDNA library Jatropha
           curcas cDNA, mRNA sequence
          Length = 700

 Score = 50.1 bits (25), Expect = 4e-06
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 119 aggtgggagctcctgcacgtgttggcctcattgcaccaattgatgttgttgtccctcctg 178
           |||| ||||||||||| || |||||  |  |||| ||||||||||| |||||||||||||
Sbjct: 512 aggttggagctcctgctcgcgttggtttggttgccccaattgatgtcgttgtccctcctg 571

            
Query: 179 g 179
           |
Sbjct: 572 g 572