Jatropha Genome Database

JcCA0045971.20
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0045971.20 - phase: 0 
         (1935 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268518677|gb|FM888920.1|FM888920 FM888920 Jatropha curcas emb...    50   1e-05

>gi|268518677|gb|FM888920.1|FM888920 FM888920 Jatropha curcas embryo
            35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_002440,
            mRNA sequence
          Length = 512

 Score = 50.1 bits (25), Expect = 1e-05
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 1228 gaacattatggatgcatggttgatcttct 1256
            |||||||||| ||||||||||||||||||
Sbjct: 267  gaacattatgcatgcatggttgatcttct 295