Jatropha Genome Database
- JcCA0028741.10
BLASTN 2.2.23 [Feb-03-2010]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= JcCA0028741.10 - phase: 0
(582 letters)
Database: JAT_13201ests
13,201 sequences; 6,040,684 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gi|268521452|gb|FM894204.1|FM894204 FM894204 Jatropha curcas emb... 172 3e-43
>gi|268521452|gb|FM894204.1|FM894204 FM894204 Jatropha curcas embryo
71-95 (DAF) Jatropha curcas cDNA clone rjcpga0_004503,
mRNA sequence
Length = 569
Score = 172 bits (87), Expect = 3e-43
Identities = 100/103 (97%), Gaps = 1/103 (0%)
Strand = Plus / Plus
Query: 1 atgattgctgctgttgatgccattcgagtaaaaggggattccattggtggagtggt-cac 59
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 467 atgattgctgctgttgatgccattcgagtaaaaggggattccatcggtggagtggtacac 526
Query: 60 atgcattgtgaggaatgccccatgtgggcttggttcgccagta 102
|||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 527 atgcatggtgaggaatgccccatgtgggcttggttcgccagta 569