Jatropha Genome Database

JcCA0009731.10
Show Alignment:  
BLASTN 2.2.23 [Feb-03-2010]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= JcCA0009731.10 + phase: 0 /partial
         (1188 letters)

Database: JAT_13201ests 
           13,201 sequences; 6,040,684 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gi|268517347|gb|FM887289.1|FM887289 FM887289 Jatropha curcas emb...    50   6e-06

>gi|268517347|gb|FM887289.1|FM887289 FM887289 Jatropha curcas embryo
            35-55 (DAF) Jatropha curcas cDNA clone rjcfea0_000452,
            mRNA sequence
          Length = 487

 Score = 50.1 bits (25), Expect = 6e-06
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1076 acactgtccattactattggcggaaattcgatgattctttcatgcgtccggtgtttggtg 1135
            ||||||| |||||||| ||||| || || |||||| | ||||||||||| || |||||||
Sbjct: 93   acactgtgcattactactggcgcaagtttgatgatgcattcatgcgtcctgtatttggtg 152

             
Query: 1136 g 1136
            |
Sbjct: 153  g 153