Jatropha Genome Database
- Jcr4S05943.40
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Jcr4S05943.40
(687 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29747.m001101 calmodulin binding protein, putative 105 3e-22
>29747.m001101 calmodulin binding protein, putative
Length = 1239
Score = 105 bits (53), Expect = 3e-22
Identities = 184/227 (81%), Gaps = 3/227 (1%)
Strand = Plus / Plus
Query: 150 tggaatgtctgagaaaatatgggaagcgacaataaagcatgcaaggacatgtgagttggg 209
||||||||| |||||||| ||||| | ||||| ||||| ||||| ||||| ||| ||||
Sbjct: 723 tggaatgtccgagaaaatgtgggaggtaacaatgaagcacgcaagaacatgcgagatggg 782
Query: 210 aaacaaacattacattttccggggacaaaattgtactgttacattgaacccaatttgtca 269
||||||||||| ||||| || ||||| | ||| ||||| || || ||||| || |||||
Sbjct: 783 gaacaaacattatatttttcgaggacagagttgcactgtcaccttaaaccctatatgtca 842
Query: 270 agttgttaatgccattattgatggtcatacctactctactagggatcttccaaccattaa 329
|||| ||| ||| | ||| |||| || || || |||||||| |||||||||| ||||
Sbjct: 843 agttcttagtgctactataaatgggcaaacatattctactagagatcttccaagcatt-- 900
Query: 330 caggggttacattgcaagtttggtgagacaagcatatgcaaattgga 376
||||| ||||||| | ||||||||||||||| ||||| |||||||
Sbjct: 901 -aggggatacattgagaatttggtgagacaagcttatgcgaattgga 946