Jatropha Genome Database
- Jcr4S05837.30
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Jcr4S05837.30
(636 letters)
Database: castor_wgs_0.1_cds
31,221 sequences; 31,347,911 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
29983.m003147 Ethylene-responsive transcription factor, putative 206 1e-52
30190.m011321 Ethylene-responsive transcription factor, putative 68 7e-11
29813.m001543 conserved hypothetical protein 54 1e-06
30190.m011323 Ethylene-responsive transcription factor, putative 52 4e-06
>29983.m003147 Ethylene-responsive transcription factor, putative
Length = 636
Score = 206 bits (104), Expect = 1e-52
Identities = 176/200 (88%)
Strand = Plus / Plus
Query: 70 gataagaaggaaatgcattacagaggagttagaaagaggccttggggtcgttacgccgcc 129
|||||||| || ||||||||||||||||| || |||||||| ||||| |||||||| ||
Sbjct: 46 gataagaaagagatgcattacagaggagtaaggaagaggccatggggccgttacgctgct 105
Query: 130 gagatacgggatccggggaagaagagccgggtctggttaggcacttttgatacggctgag 189
|||||||| || ||||| || ||||| |||||||||||||||||||||||||| |||||
Sbjct: 106 gagatacgtgacccgggtaaaaagagtcgggtctggttaggcacttttgatacagctgaa 165
Query: 190 gaagctgctacagcttatgacaaggcggcgcgtgaattccgtggccctaaggccaagact 249
|||||||||| |||||| ||||||||||||||||| |||||||| |||| |||||||||
Sbjct: 166 gaagctgctagagcttacgacaaggcggcgcgtgagttccgtggtgctaaagccaagact 225
Query: 250 aactttcctcttcccaccga 269
|| || ||||| ||||||||
Sbjct: 226 aatttccctctacccaccga 245
Score = 60.0 bits (30), Expect = 2e-08
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 306 tgatgacccaagtcctagccagagcagcacggttgaatcctccagtccgccggctgcgcg 365
|||| |||| || |||||||||||||| || ||||| || |||||||| ||||| |||||
Sbjct: 291 tgataacccgagccctagccagagcagtactgttgagtcttccagtcctccggcggcgcg 350
Query: 366 tgagat 371
||||||
Sbjct: 351 tgagat 356
Score = 60.0 bits (30), Expect = 2e-08
Identities = 56/65 (86%), Gaps = 6/65 (9%)
Strand = Plus / Plus
Query: 391 aggtttccgtttgtttatcagca------gcagaacgtggtgggtccggtttggtttttt 444
||||||||||||||||||||||| ||||| ||| ||||| |||||||||||||||
Sbjct: 385 aggtttccgtttgtttatcagcaacagcagcagagcgttgtgggcccggtttggtttttt 444
Query: 445 gatgg 449
|||||
Sbjct: 445 gatgg 449
>30190.m011321 Ethylene-responsive transcription factor, putative
Length = 768
Score = 67.9 bits (34), Expect = 7e-11
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 83 tgcattacagaggagttagaaagaggccttggggtcgttacgccgccgagatacgggatc 142
|||||| |||||||||||||||||| || |||||| | ||||| || |||||| | ||||
Sbjct: 77 tgcatttcagaggagttagaaagagaccatggggtagatacgcggcggagataagagatc 136
Query: 143 cggggaagaagagc 156
| ||||||||||||
Sbjct: 137 cagggaagaagagc 150
>29813.m001543 conserved hypothetical protein
Length = 1188
Score = 54.0 bits (27), Expect = 1e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 163 tggttaggcacttttgatacggctgaggaagctgctacagcttatga 209
||||||||||| | |||||| |||||||||||||| | |||||||||
Sbjct: 205 tggttaggcacatatgatactgctgaggaagctgcaagagcttatga 251
>30190.m011323 Ethylene-responsive transcription factor, putative
Length = 525
Score = 52.0 bits (26), Expect = 4e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 88 tacagaggagttagaaagaggccttggggtcgttacgc 125
||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 46 tacagaggagtgagaaagaggccatggggccgttacgc 83