Jatropha Genome Database

Jcr4S00006.270
Show Alignment:  
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Jcr4S00006.270
         (789 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29996.m000132 conserved hypothetical protein                           74   1e-12

>29996.m000132 conserved hypothetical protein
          Length = 768

 Score = 73.8 bits (37), Expect = 1e-12
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                
Query: 706 cctccttatatagctaaaggagctgcaaatctgtttggtttgggatctctttt 758
           |||||||| || |||||||||||||||||||| ||||||||||||||| ||||
Sbjct: 685 cctccttacattgctaaaggagctgcaaatctttttggtttgggatctttttt 737



 Score = 58.0 bits (29), Expect = 8e-08
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                       
Query: 1  atgtgttcagaaacaagccctcgtatatcattctctaatgatctt 45
          ||||| ||| ||||||||||||| ||||||||||| |||||||||
Sbjct: 1  atgtgctcacaaacaagccctcgaatatcattctccaatgatctt 45