Jatropha Genome Database

Jcr4S00006.260
Show Alignment: 
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Jcr4S00006.260 /short
         (225 letters)

Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

29996.m000133 amsh, putative                                          337   2e-92

>29996.m000133 amsh, putative
          Length = 1545

 Score =  337 bits (170), Expect = 2e-92
 Identities = 206/218 (94%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgttgccagaatctgttgccattgtcatggcaccaagagatacttcaagaaaacatggc 60
            |||||||||||||| ||||||||||||||||| |||||||||||||||||||  ||||||
Sbjct: 1321 atgttgccagaatccgttgccattgtcatggcgccaagagatacttcaagaacccatggc 1380

                                                                        
Query: 61   atttttcggttgacatcccctggtggcatgtccgttataagacactgccagcaacgtgga 120
            ||||||||||||||| |||||||||||||||| ||||||||| |||||||||||||||||
Sbjct: 1381 atttttcggttgacaacccctggtggcatgtcagttataagaaactgccagcaacgtgga 1440

                                                                        
Query: 121  tttcatccacatgatcaacctccagatggtgggccgatttacaacacctgtacagatgtc 180
            |||||||| |||||||||||||||||||||||||| || ||||| |||||||||||||||
Sbjct: 1441 tttcatccgcatgatcaacctccagatggtgggcccatctacaagacctgtacagatgtc 1500

                                                  
Query: 181  tatatgaatcccaacctaaagtttgatgttattgacct 218
            ||||||||||||||||||||||||||||| ||||||||
Sbjct: 1501 tatatgaatcccaacctaaagtttgatgtcattgacct 1538