Jatropha Genome Database
- Jcr4S05837.30
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
Query= Jcr4S05837.30
         (636 letters)
Database: castor_wgs_0.1_cds 
           31,221 sequences; 31,347,911 total letters
Searching..................................................done
                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
29983.m003147 Ethylene-responsive transcription factor, putative      206   1e-52
30190.m011321 Ethylene-responsive transcription factor, putative       68   7e-11
29813.m001543 conserved hypothetical protein                           54   1e-06
30190.m011323 Ethylene-responsive transcription factor, putative       52   4e-06
>29983.m003147 Ethylene-responsive transcription factor, putative
          Length = 636
 Score =  206 bits (104), Expect = 1e-52
 Identities = 176/200 (88%)
 Strand = Plus / Plus
                                                                       
Query: 70  gataagaaggaaatgcattacagaggagttagaaagaggccttggggtcgttacgccgcc 129
           |||||||| || ||||||||||||||||| || |||||||| ||||| |||||||| || 
Sbjct: 46  gataagaaagagatgcattacagaggagtaaggaagaggccatggggccgttacgctgct 105
                                                                       
Query: 130 gagatacgggatccggggaagaagagccgggtctggttaggcacttttgatacggctgag 189
           |||||||| || ||||| || ||||| |||||||||||||||||||||||||| ||||| 
Sbjct: 106 gagatacgtgacccgggtaaaaagagtcgggtctggttaggcacttttgatacagctgaa 165
                                                                       
Query: 190 gaagctgctacagcttatgacaaggcggcgcgtgaattccgtggccctaaggccaagact 249
           |||||||||| |||||| ||||||||||||||||| ||||||||  |||| |||||||||
Sbjct: 166 gaagctgctagagcttacgacaaggcggcgcgtgagttccgtggtgctaaagccaagact 225
                               
Query: 250 aactttcctcttcccaccga 269
           || || ||||| ||||||||
Sbjct: 226 aatttccctctacccaccga 245
 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 57/66 (86%)
 Strand = Plus / Plus
                                                                       
Query: 306 tgatgacccaagtcctagccagagcagcacggttgaatcctccagtccgccggctgcgcg 365
           |||| |||| || |||||||||||||| || ||||| || |||||||| ||||| |||||
Sbjct: 291 tgataacccgagccctagccagagcagtactgttgagtcttccagtcctccggcggcgcg 350
                 
Query: 366 tgagat 371
           ||||||
Sbjct: 351 tgagat 356
 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 56/65 (86%), Gaps = 6/65 (9%)
 Strand = Plus / Plus
                                                                       
Query: 391 aggtttccgtttgtttatcagca------gcagaacgtggtgggtccggtttggtttttt 444
           |||||||||||||||||||||||      ||||| ||| ||||| |||||||||||||||
Sbjct: 385 aggtttccgtttgtttatcagcaacagcagcagagcgttgtgggcccggtttggtttttt 444
                
Query: 445 gatgg 449
           |||||
Sbjct: 445 gatgg 449
>30190.m011321 Ethylene-responsive transcription factor, putative
          Length = 768
 Score = 67.9 bits (34), Expect = 7e-11
 Identities = 64/74 (86%)
 Strand = Plus / Plus
                                                                       
Query: 83  tgcattacagaggagttagaaagaggccttggggtcgttacgccgccgagatacgggatc 142
           |||||| |||||||||||||||||| || |||||| | ||||| || |||||| | ||||
Sbjct: 77  tgcatttcagaggagttagaaagagaccatggggtagatacgcggcggagataagagatc 136
                         
Query: 143 cggggaagaagagc 156
           | ||||||||||||
Sbjct: 137 cagggaagaagagc 150
>29813.m001543 conserved hypothetical protein
          Length = 1188
 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus
                                                          
Query: 163 tggttaggcacttttgatacggctgaggaagctgctacagcttatga 209
           ||||||||||| | |||||| |||||||||||||| | |||||||||
Sbjct: 205 tggttaggcacatatgatactgctgaggaagctgcaagagcttatga 251
>30190.m011323 Ethylene-responsive transcription factor, putative
          Length = 525
 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus
                                                 
Query: 88  tacagaggagttagaaagaggccttggggtcgttacgc 125
           ||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 46  tacagaggagtgagaaagaggccatggggccgttacgc 83