FLJ00029

Gene/Protein Characteristic Table for FLJ00029

Order Kazusa clone(s) from :

Product ID	ORK05771
Accession No	AK024439
Clone name	as00029
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4125 bp) Predicted protein sequence (240 aa)
Source	Human spleen

Length: 4125 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Features of the protein sequence

Description

Length: 240 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15729	7.8e-107	100.0	FLJ00029 protei...	Homo sapiens
AAL35594	1.3e-105	99.6	kelch-like prot...	Homo sapiens
Q8WZ60	1.3e-105	99.6	Kelch-like prot...	Homo sapiens
XP_001106193	1.3e-105	99.6	kelch-like 6 [M...	Macaca mulatta
BAC04957	1.3e-105	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067508	2.9e-21	31.7	KIAA1921
AB051474	2e-18	26.9	KIAA1687
AB040923	2e-18	28.0	KIAA1490
AB018338	7.5e-17	27.7	KIAA0795
AB032955	2.3e-15	27.9	KIAA1129

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR006651	39	52	PR00501	Kelch motif
	IPR006651	56	70	PR00501	Kelch motif
	IPR006651	161	173	PR00501	Kelch motif
HMMPfam	NULL	29	74	PF07646	NULL
	IPR006652	29	74	PF01344	Kelch repeat
	NULL	76	122	PF07646	NULL
	IPR006652	76	122	PF01344	Kelch repeat
	IPR006652	124	164	PF01344	Kelch repeat
	NULL	166	212	PF07646	NULL
	IPR006652	166	212	PF01344	Kelch repeat

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGGTTAAGGGACTCCAGTTGC
Primer_r	TGTATTTCCCTGAGAGCGTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp