| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK05067 | 
|---|---|
| Accession No | AK024488 | 
| Clone name | as00087 | 
| Vector information | |
| cDNA sequence | DNA sequence (4287 bp) Predicted protein sequence (674 aa)  | 
| Source | Human spleen | 
| Rouge ID | 
    mFLJ00087
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 4287 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | Warning | 
 
        Length: 674 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against other entries from Kazusa human cDNA project
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR000008 | 37 | 115 | PF00168 | C2 domain | 
| IPR001936 | 210 | 382 | PF00616 | Ras GTPase-activating protein | |
| HMMSmart | IPR001936 | 138 | 460 | SM00323 | Ras GTPase-activating protein | 
| ProfileScan | IPR001936 | 189 | 381 | PS50018 | Ras GTPase-activating protein | 
| NULL | 520 | 560 | PS50323 | NULL | 
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | AGTACATGAAGCTCGTGGCAC | 
|---|---|
| Primer_r | AGGGAACCAGTCGTAGGAATG | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  |