|
Order Kazusa clone(s) from : |
| Product ID | ORK07192 |
|---|---|
| Accession No | AK024447 |
| Clone name | as00037 |
| Vector information | |
| cDNA sequence | DNA sequence (4602 bp) Predicted protein sequence (145 aa) |
| Source | Human spleen |
| Rouge ID |
mFLJ00037
by Kazusa Mouse cDNA Project
|
Length: 4602 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Length: 145 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project
(FASTA output,
Multiple alignment)
RT-PCR-ELISA
|
Experimental conditions| Primer_f | TCCTGGAGATGAAGCTGAAGC |
|---|---|
| Primer_r | GGGACCACAGTGTTGAAGCAG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |