Order Kazusa clone(s) from : ![]() |
Product ID | ORK04204 |
---|---|
Accession No | AK024423 |
Clone name | as00012 |
Vector information | |
cDNA sequence | DNA sequence (4577 bp) Predicted protein sequence (182 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00012
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001680 | 47 | 84 | PF00400 | G-protein beta WD-40 repeat |
IPR001680 | 91 | 128 | PF00400 | G-protein beta WD-40 repeat | |
HMMSmart | IPR001680 | 45 | 84 | SM00320 | G-protein beta WD-40 repeat |
IPR001680 | 89 | 128 | SM00320 | G-protein beta WD-40 repeat | |
ProfileScan | IPR001680 | 52 | 85 | PS50082 | G-protein beta WD-40 repeat |
IPR001680 | 52 | 137 | PS50294 | G-protein beta WD-40 repeat | |
IPR001680 | 96 | 137 | PS50082 | G-protein beta WD-40 repeat | |
ScanRegExp | IPR001680 | 71 | 85 | PS00678 | G-protein beta WD-40 repeat |
![]() |
Primer_f | CGATGGCTTCAAGTGTGGTTC |
---|---|
Primer_r | AATGGGGTCCCTGTAGTCTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |