KMC004238A_c01
[Fasta Sequence]   [Nr Search]   [EST assemble image]  

Fasta Sequence
>KMC004238A_C01 KMC004238A_c01
AATCCAGGTGAATAATTCACTAGCAAGGAGAACACACAGAATCTATACTAGACAGGGTTA
GAGTAACCTTTGGAATCAGAAAAAAGnTTTGCTGnTATCCAGCCTGACATCAACACTAGC
ACnTATCCAnCAAATAAAATATAATGTAACAGTGCAACATGTATACATATAGGCATGCTC
ATATCTGGGGGGAAAATTCACAGAAAGTTGTATAAACTAACAACATTCTTCACTGGCTGT
TGCTTGTCTTCTGCTTGGCCTTCTCAAT


Nr search

BLASTX 2.2.2 [Dec-14-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= KMC004238A_C01 KMC004238A_c01
         (268 letters)

Database: nr 
           1,393,205 sequences; 448,689,247 total letters

Searching..................................................done

 ***** No hits found ******

  Database: nr
    Posted date:  Apr 1, 2003  2:05 AM
  Number of letters in database: 448,689,247
  Number of sequences in database:  1,393,205
  
Lambda     K      H
   0.318    0.135    0.401 

Gapped
Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Hits to DB: 200,764,219
Number of Sequences: 1393205
Number of extensions: 3051594
Number of successful extensions: 6481
Number of sequences better than 10.0: 0
Number of HSP's better than 10.0 without gapping: 6439
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 6481
length of database: 448,689,247
effective HSP length: 64
effective length of database: 359,524,127
effective search space used: 8628579048
frameshift window, decay const: 50,  0.1
T: 12
A: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)


EST assemble image


clone accession position
1 MR019c06_f BP077418 1 349
2 MPD001a11_f AV770045 82 266




Lotus japonicus
Kazusa DNA Research Institute