Gene/Protein Characteristic Table for FLJ00034

Description

Product ID:	ORK03385
Accession No.:	AK024444
Alias Name:
Clone Name:	as00034 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 4305
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the predicted protein sequence	Description

Length: 1343

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB15734	0	100.0	FLJ00034 protei...	Homo sapiens
Q9H7N4	0	100.0	Splicing factor...	Homo sapiens
AAF87552	0	99.9	ser/arg-rich pr...	Homo sapiens
XP_001253211	3.6e-159	93.1	similar to FLJ0...	Bos taurus
XP_541491	8.7e-151	78.4	similar to seri...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040975	3.9e-06	25.3	KIAA1542
AB002322	0.00036	24.8	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR003993 919 937 PR01503 Treacher Collins syndrome protein Treacle

IPR003993 1053 1066 PR01503 Treacher Collins syndrome protein Treacle

ProfileScan IPR000694 215 298 PS50099 Proline-rich region

NULL 222 238 PS50324 NULL

NULL 299 319 PS50313 NULL

IPR000694 411 472 PS50099 Proline-rich region

NULL 565 859 PS50324 NULL

NULL 587 685 PS50323 NULL

IPR001472 624 641 PS50079 Bipartite nuclear localization signal

NULL 927 957 PS50318 NULL

NULL 1040 1070 PS50313 NULL

IPR000694 1315 1342 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003993	919	937	PR01503	Treacher Collins syndrome protein Treacle
IPR003993	1053	1066	PR01503	Treacher Collins syndrome protein Treacle
ProfileScan	IPR000694	215	298	PS50099	Proline-rich region
NULL	222	238	PS50324	NULL
NULL	299	319	PS50313	NULL
IPR000694	411	472	PS50099	Proline-rich region
NULL	565	859	PS50324	NULL
NULL	587	685	PS50323	NULL
IPR001472	624	641	PS50079	Bipartite nuclear localization signal
NULL	927	957	PS50318	NULL
NULL	1040	1070	PS50313	NULL
IPR000694	1315	1342	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

Expression profile

RT-PCR-ELISA	Description

Experimental conditions

Primer_f	: TATCTGAAGAAGCTGCACACG
Primer_r	: TTGATTTCCCCACTTTTGCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO